JSON API Documentation

T7 IVT Helper Web Interface

Overview

This tool designs DNA oligonucleotides to be used in T7 in vitro transcription (IVT) to generate RNA molecules of interest.

Designed ssDNA templates are ready for IVT after annealing a T7 promoter primer. However, it may be desirable to amplify templates in order to produce more material.

All templates designed with this tool can be amplified using the T7 promoter and T7 terminator PCR primers, which are available as IDT ReadyMade PCR primers.

Main endpoint

To design templates, use:

GET https://www.conorcamplisson.com/t7_ivt_helper/api/<RNA sequence>

Returns:

{
    "success": true,
    "fwd_primer": "TAATACGACTCACTATAGGG",
    "rev_primer": "GCTAGTTATTGCTCAGCGG",
    "ivt_template": "<T7 IVT ssDNA Template Sequence>"
}

Python example

import requests
API_URL = 'https://conorcamplisson.com/t7_ivt_helper/api/'
rna_seq = 'ACACGUCAUCGACUACUAGCAGUCAUGCAGUCGAUCA'
json_data = requests.get(API_URL + rna_seq).json()
print(json_data)

Output:

{
    "success": true,
    "fwd_primer": "TAATACGACTCACTATAGGG",
    "rev_primer": "GCTAGTTATTGCTCAGCGG",
    "ivt_template": "GCTAGTTATTGCTCAGCGGTGATCGACTGCATGACTGCTAGTAGTCGATGACGTGTCCCTATAGTGAGTCGTATTA"
}